Modèle procès verbal de carence

L`essentiel pour les réunions hebdomadaires ou mensuelles de progrès est que toutes les parties sont attendues pour les assister: propriétaire, entrepreneur (et même parfois sous-traitants), architectes, et ingénieurs. Cela signifie que le procès-verbal de la réunion reflète l`opinion de toutes les parties et doit fournir une documentation complète, fiable et exacte sur l`état actuel du projet ainsi que les prochaines étapes, comme convenu par toutes les parties. Ils aident l`équipe du projet à suivre les progrès de la construction, ce qui a été discuté, ce qui a été résolu, qui a assisté à la réunion et un tas d`autres articles. Le groupe de recherche a généré un nouveau Knockout CrT omniprésent comme modèle de souris pour la carence de transporteur de créatine avec une grande suppression de 3 exon dans le gène Slc6a8. Le phénotypage biochimique a révélé une carence en créatine dans le cerveau, le muscle, le cœur et les reins et les tests comportementaux ont révélé des similitudes phénotypiques avec les patients atteints de CrT. Par conséquent, le nouveau modèle de souris semble être un outil valide pour étudier la carence en créatine transporteur. Les minutes de réunion doivent être distribuées à l`ensemble de l`équipe, pas seulement aux participants. En règle générale, lors de la première réunion, le détenteur du procès-verbal demandera une liste de distribution de toutes les parties fréquentant les participants et cette liste devrait être tenue à jour pendant toute la durée du projet. PCR a été réalisée avec Taq polymérase et d`autres réactifs dans le Platinum PCR SuperMix (Invitrogen Corp., Carlsbad, California, USA). Chaque cycle de dénaturation (93 ° c pendant 30 secondes), de recuit (59 ° c pendant 30 secondes) et d`extension (65 ° c pendant 2 minutes) a été répété 40 fois. Deux amorces à l`avant et à deux inverses ont été utilisées pour génotype des animaux.

Un Primer avant (1F) (CTCTGTTATTACATAGCTAGTCAAGG) a été amplifié à partir d`un point situé près de l`extrémité 5 ′ de l`intron 6, tandis que l`autre (2F) (CTTGCAAAATGGCGTTACTTAAGC) utilisait une séquence dans la répétition de la longue borne. Les deux amorces inverses amplifiées à partir de séquences près de l`extrémité 3 ′ de l`intron 6 (CAGATACCCCTTATTAGCTCTTCCT, Primer 1R) et dans l`exon 7 (TACCACGATCACAAAGCTCAGGTTG, Primer 2R). En utilisant ces amorces, l`amplification de l`ADN génomique de souris de type sauvage a produit des bandes de 300 BP (1F → 2R) et 210 BP (1F → 1R) (figure (Figure11 et figure Figure2a). 2a). L`ADN génomique des souris déficientes homozygotes a produit des bandes de 200 BP (2F → 2R) et 150 BP (2F → 1R) (figure (Figure11 et figure Figure22a). Ce guide sur la façon d`écrire des procès-verbaux de réunion a été préparé par Wild Apricot pour aider les bénévoles et/ou le personnel des petits organismes sans but lucratif et membres qui peuvent être nouveaux à la tâche de prendre et de préparer des procès-verbaux de réunion pour les comités ou les conseils d`administration. Veuillez noter que puisque le format, le style et les exigences de contenu pour les minutes de réunion varient en fonction de l`organisation et du type de Comité ou de Conseil, cet article n`offre que des directives générales pour vous aider à commencer.


  • Žádné rubriky
Červenec 2019
Po Út St Čt So Ne
« Úno